List of tablesTable2.1. Agarose gel (1%)Table 2.2. (TBE)Tris borate EDTA buffer (10X)Table 2.3. TBE(1X)Table 2.4. Gel Loading Dye (6X)Table 2.5. Ethidium bromide solutionTable 2.6. Allele-specific PCR primersTable 2.7. PCR reaction mixture and cycling conditionsTable 2.8. PCR reaction mixtureTable 2.9. SNP PCR (total reaction volume 50 µl)Chapter 2: Materials and methodsMaterialsTable2.1. Agarose gel (1%)Serial no. Ingredient Quantity (g/L) 1 Agarose gel 12 TBE buffer (1X) 100 mlTable 2.2. (TBE) Tris borate EDTA buffer (10X) Serial number Quantity of ingredient (g/L) 1 Tris base 542 Boric acid 27.53 EDTA 0.5 M 20 ml4 dH2O up to 500 mlTable 2.3. TBE(1X)Serial number Quantity of ingredient (ml/L)1 10X TBE 1002 dH2O 900 mlTable 2.4. Gel Loading Dye (6X)Serial No. Ingredient Quantity1 Bromophenol Blue 0.025 g2 Xylene Cyanol 0.025 g3 Glycerol 3 ml4 dH2O 7 mlTotal 10 mlTable 2.5. Ethidium bromide solutionSerial number Ingredient quantity1 Ethidium bromide 10 mg2 dH2O 1 mlTable 2.6. Allele-specific PCR primersі)rs9818870Sr no. Primer sequence dbSNP Base pair position Tm Ta Product1 F1.3 5'--- GCT GCTTGGTGCCTCTCTGATAC---3' C/T 61.5 61.2 667bp2 F2.3 5'--- GCTGCTTGGTGCCTCTCTGATAT -- -3'C/T 60.4 61.2 667bp3 R3 5'--- CGAGGTAGGAACACAGCACA ---3'C/T 58.2 61.2 667bp ii)rs2258287 Sr no. Primer sequence dbSNP Base pair position Tm Ta Product1 F1.11 5'--- CGTCATGAAGGAGGCTTGATAACG ---3' G/T 58.8 578bp2 F2.11 5'--- CGTCATGAAGGAGGCTTGATAACT ---3' G /T 57.6 59.4 578bp3 R11 5'--- ACTGCTCTTGGCAACAACCT---3'G/T 58.2 578bpTable 2.7. PCR reaction mix and cycling conditionsі).Gradient PCRSerial no. Conc. Wor chemical stocks...... middle of paper...... so as not to damage the casting tray. The gel was poured into a gel casting tray and the comb was inserted. The gel was allowed to solidify for approximately half an hour. The comb was removed and the tray was placed in the gel apparatus. The sample was prepared by mixing a DNA sample with the loading dye in a 3:1 ratio (e.g., 3 µl of DNA sample was mixed with 1 µl of loading dye). The samples were loaded into the wells carefully by releasing the sample to the bottom of the well but with vigilance so as not to rip out the well. Power was set at 100 or 80 V for genomic DNA and PCR products respectively and the gel was applied until the dye reached two-thirds of the gel. The power supply was turned off and the gel was placed in staining solution for 15 min (5 µl ethidium bromide per 100 ml water). The gel was observed under UV light to see the location and intensity of the DNA bands..